WHP Posttranscriptional Response Element

Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long: GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT

WHP Posttranscriptional Response Element

Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long: GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT